EST translation and GO annotation for unigene RU39511


ESTScan predicted protein sequence

MGECDRSLEEDRWNGVWX

ESTScan predicted coding region in original sequence      Start : 24 End : 76 Strand : minus

AGAGAGAGAGAGTTATATGAAAAATGGGGGAGTGCGACCGGTCTTTGGAGGAAGATAGATGGAATGGGGTTTGGTGX


X -- added by ESTScan; agctn -- deleted by ESTScan; AGCTN -- CDS



InterProtein domain annotations

Pfam domain annotations

GO terms for RU39511 (based on the top Swiss-Prot and TrEMBL hits)


GO Biological Process
GO Molecular Function
GO Cellular Component