EST translation and GO annotation for unigene RU43019


ESTScan predicted protein sequence

EVLELAGNAARDNKKTRIVPRHIQLAVPETKRKERN

ESTScan predicted coding region in original sequence      Start : 1 End : 111 Strand : minus


GAGGTTTTGGAACTGGCCGGAAATGCAGCCAGGGACAACAAGAAGACTCGGATTGTGCCACGTCACATCCAATTGGCCGTACCGGAAACG
AAACGAAAGGAAAGAAACTAAACGGAAAACAAAAAGGAAAACTTAAAACT


X -- added by ESTScan; agctn -- deleted by ESTScan; AGCTN -- CDS



InterProtein domain annotations

Pfam domain annotations

PF00125    Core histone H2A/H2B/H3/H4

        GO:0003677     GO:0003677

GO terms for RU43019 (based on the top Swiss-Prot and TrEMBL hits)


GO Biological Process
   GO:0006334-nucleosome assembly
GO Molecular Function
   GO:0003677-DNA binding
GO Cellular Component
   GO:0000786-nucleosome
  GO:0005634-nucleus
  GO:0005694-chromosome