EST translation and GO annotation for unigene RU49849


ESTScan predicted protein sequence

MSPVLSSQGLVLATAMAISSHPR

ESTScan predicted coding region in original sequence      Start : 96 End : 163 Strand : plus

CGAGACATTAGAAGCCTCTGACTCCTCTCTCTCTCTCTCTCTGTGAGCCTCTAGTCTCTTCCTTGTCAACCGTCCTTAGTAATTTTGTCA
CCGCCATGTCTCCTGTGCTAAGCTCTCAAGGTCTGGTCTTAGCAACCGCCATGGCTATCTCTAGCCACCCTCGX


X -- added by ESTScan; agctn -- deleted by ESTScan; AGCTN -- CDS



InterProtein domain annotations

Pfam domain annotations

GO terms for RU49849 (based on the top Swiss-Prot and TrEMBL hits)


GO Biological Process
GO Molecular Function
GO Cellular Component