RU04534 sequence (244 bp)


Member Information
GTTTAATTAGTTTTCCTTTAAAGTCTACTAAAGTTAAGTGGTTTGCAAGTACCCATGAAGATGTGCTCGTAGGCATCTATCC
CAAACAATTGTGCTCCTTTAACTGATGTTCCAACTGTGATAGTTGGCCCAATTTTGTTGATAGTGCACTCAGGACAATACCA
GGATCCTTCTGGTATCGACAGTTTCATCACACCTATACACCTCGTATGGTAGGCGGATGGGCATCCATCACAGCAAAGCA


RU04534 Expression


Digital Expression:
ControlEthyleneWDSGenBankTotal
09009

Probe ID Probe Sequeces
yueji_14174AATACCAGGATCCTTCTGGTATCGACAGTTTCATCACACCTATACACCTCGTATGGTAGG bl2seq


RU04534 Annotation


GenBank top hits
Blast detail
Accession No. Description Score e value
CAO16702 unnamed protein product [Vitis vinifera] 309 3e-027
BAB11682 unnamed protein product [Arabidopsis thaliana] 271 8e-023
NP_197668 PHD finger family protein [Arabidopsis thaliana] 271 8e-023
BAA98208 unnamed protein product [Arabidopsis thaliana] 268 2e-022
NP_198371 peptidase M50 family protein / sterol-regulatory element binding protein (SREBP) site 2 protease family protein [Arabidopsis thaliana] 252 1e-020

Swiss-Prot top hits
Blast detail
Accession No. Description Score e value
O97159 Chromodomain-helicase-DNA-binding protein Mi-2 homolog 125 4e-007
Q8TDI0 Chromodomain-helicase-DNA-binding protein 5 122 1e-006
O16102 Chromodomain-helicase-DNA-binding protein 3 121 1e-006
Q96L73 Histone-lysine N-methyltransferase, H3 lysine-36 and H4 lysine-20 specific 121 1e-006
O88491 Histone-lysine N-methyltransferase, H3 lysine-36 and H4 lysine-20 specific 121 1e-006

TrEMBL top hits
Blast detail
Accession No. Description Score e value
B9SN69 DNA binding protein, putative 318 3e-028
A7PQK3 Chromosome chr6 scaffold_25, whole genome shotgun sequence 309 3e-027
B9HQK7 Predicted protein 304 1e-026
Q9FNI5 Gb|AAC80581.1 271 8e-023
Q9LHR7 Genomic DNA, chromosome 5, TAC clone:K3D20 268 2e-022

Arabidopsis top hits
Blast detail
Accession No. Description Score e value
AT5G22760.1 PHD finger family protein 271 4e-025
AT5G35210.1 peptidase M50 family protein / sterol-regulatory element binding protein (SREBP) site 2 protease family protein 252 7e-023
AT5G35210.2 peptidase M50 family protein / sterol-regulatory element binding protein (SREBP) site 2 protease family protein 252 7e-023
AT5G12400.1 PHD finger transcription factor, putative 189 1e-015
AT1G05380.1 DNA binding 129 1e-008