Member Information |
GTTTAATTAGTTTTCCTTTAAAGTCTACTAAAGTTAAGTGGTTTGCAAGTACCCATGAAGATGTGCTCGTAGGCATCTATCC CAAACAATTGTGCTCCTTTAACTGATGTTCCAACTGTGATAGTTGGCCCAATTTTGTTGATAGTGCACTCAGGACAATACCA GGATCCTTCTGGTATCGACAGTTTCATCACACCTATACACCTCGTATGGTAGGCGGATGGGCATCCATCACAGCAAAGCA |
Digital Expression: |
Control | Ethylene | WDS | GenBank | Total |
---|---|---|---|---|
0 | 9 | 0 | 0 | 9 |
Probe ID | Probe Sequeces |
yueji_14174 | AATACCAGGATCCTTCTGGTATCGACAGTTTCATCACACCTATACACCTCGTATGGTAGG bl2seq |
GenBank top hits |
Blast detail |
Accession No. | Description | Score | e value |
---|---|---|---|
CAO16702 | unnamed protein product [Vitis vinifera] | 309 | 3e-027 |
BAB11682 | unnamed protein product [Arabidopsis thaliana] | 271 | 8e-023 |
NP_197668 | PHD finger family protein [Arabidopsis thaliana] | 271 | 8e-023 |
BAA98208 | unnamed protein product [Arabidopsis thaliana] | 268 | 2e-022 |
NP_198371 | peptidase M50 family protein / sterol-regulatory element binding protein (SREBP) site 2 protease family protein [Arabidopsis thaliana] | 252 | 1e-020 |
Swiss-Prot top hits |
Blast detail |
Accession No. | Description | Score | e value |
---|---|---|---|
O97159 | Chromodomain-helicase-DNA-binding protein Mi-2 homolog | 125 | 4e-007 |
Q8TDI0 | Chromodomain-helicase-DNA-binding protein 5 | 122 | 1e-006 |
O16102 | Chromodomain-helicase-DNA-binding protein 3 | 121 | 1e-006 |
Q96L73 | Histone-lysine N-methyltransferase, H3 lysine-36 and H4 lysine-20 specific | 121 | 1e-006 |
O88491 | Histone-lysine N-methyltransferase, H3 lysine-36 and H4 lysine-20 specific | 121 | 1e-006 |
TrEMBL top hits |
Blast detail |
Accession No. | Description | Score | e value |
---|---|---|---|
B9SN69 | DNA binding protein, putative | 318 | 3e-028 |
A7PQK3 | Chromosome chr6 scaffold_25, whole genome shotgun sequence | 309 | 3e-027 |
B9HQK7 | Predicted protein | 304 | 1e-026 |
Q9FNI5 | Gb|AAC80581.1 | 271 | 8e-023 |
Q9LHR7 | Genomic DNA, chromosome 5, TAC clone:K3D20 | 268 | 2e-022 |
Arabidopsis top hits |
Blast detail |
Accession No. | Description | Score | e value |
---|---|---|---|
AT5G22760.1 | PHD finger family protein | 271 | 4e-025 |
AT5G35210.1 | peptidase M50 family protein / sterol-regulatory element binding protein (SREBP) site 2 protease family protein | 252 | 7e-023 |
AT5G35210.2 | peptidase M50 family protein / sterol-regulatory element binding protein (SREBP) site 2 protease family protein | 252 | 7e-023 |
AT5G12400.1 | PHD finger transcription factor, putative | 189 | 1e-015 |
AT1G05380.1 | DNA binding | 129 | 1e-008 |
|