RU08989 sequence (324 bp)


Member Information
AGAGGGGTTTCTTCAGAGGGCGTCTTAATAAACGCCTTCGACCTTTTCTTCTTCTTCTTCTTCTTCTTCTCTCTTATTCTCT
TCGTGTTTCTCTGTGTGCGATTTTCATCGTTTCAAAATGAGAGAGTGCATTTCGATCCACATCGGTCAGGCCGGTATTCAGG
TCGGCAATGCCTGCTGGGAGCTTTATTGCCTTGAGCATGGTATCCAGCCTGATGGCCAAATGCCAAGTGACAAGACTGTAGG
CGGAGGAGACGATGCCTTCAACACCTTTTTCAGTGAAACTGGTGCCGGGAAGCATGTCCCTCACGCAATCTTTGTTGA


RU08989 Expression


Digital Expression:
ControlEthyleneWDSGenBankTotal
21003

Probe ID Probe Sequeces


RU08989 Annotation


GenBank top hits
 Blast detail
Accession No. Description Score e value
AAO63781 alpha-tubulin 1 [Populus tremuloides] 370 2e-034
AAO73546 alpha-tubulin [Ceratopteris richardii] 370 2e-034
AAO23139 alpha tubulin [Populus tremuloides] 370 2e-034
ABF13307 alpha-tubulin [Phaseolus vulgaris] 370 2e-034
ABO47737 alpha-tubulin [Gossypium hirsutum] 370 2e-034

Swiss-Prot top hits
 Blast detail
Accession No. Description Score e value
P29510 Tubulin alpha-2/alpha-4 chain 369 2e-035
Q6VAG0 Tubulin alpha-2 chain 369 2e-035
Q6VAF9 Tubulin alpha-4 chain 369 2e-035
P46259 Tubulin alpha-1 chain 365 6e-035
Q96460 Tubulin alpha-2 chain 365 6e-035

TrEMBL top hits
 Blast detail
Accession No. Description Score e value
A9PHZ8 Putative uncharacterized protein 370 2e-034
A9PL16 Alpha-tubulin 370 2e-034
Q1KSI0 Alpha-tubulin (Fragment) 370 2e-034
Q84TK6 Alpha-tubulin 1 370 2e-034
Q84UZ5 Alpha-tubulin 370 2e-034

Arabidopsis top hits
 Blast detail
Accession No. Description Score e value
AT1G04820.1 TUA4; structural constituent of cytoskeleton 369 2e-036
AT1G50010.1 TUA2; structural constituent of cytoskeleton 369 2e-036
AT4G14960.1 TUA6; structural constituent of cytoskeleton 365 5e-036
AT4G14960.2 TUA6; structural constituent of cytoskeleton 365 5e-036
AT5G19770.1 TUA3; structural constituent of cytoskeleton 323 4e-031