Member Information |
| AAAGGTTTGGTCTTCTAAGTAACCGTTTGTAATTTTTACGTAGCACGAGCAACAGTCAATTTGTCATCTTCACTAAGCTCAT CCATCCCCAAAATTGCAATAATATCTTGCAGATTCTTATAGTTTTGAAGAACTTTCTGAACACCACGAGCAGTGTTGTAGTG TTCTTCTCCTAGAATATGAGGCGAGAGCATTACCAGTTTCCAGGGAGTTCTGGATGGGAAATATGATGATCTTTCTGAGCAA TCGTTCTATATGGTTGGTGGAATTGAAGAAGTCATTGCTAAGGCAGAGAAGATTGCCAAGGAAAATGCTTAGGTCATGTGGC TATTTTCTGTTATCCTGAATTTCCAAAG |
Digital Expression: |
| Control | Ethylene | WDS | GenBank | Total |
|---|---|---|---|---|
| 1 | 1 | 0 | 0 | 2 |
| Probe ID | Probe Sequeces |
| yueji_04474 | TGGTGGAATTGAAGAAGTCATTGCTAAGGCAGAGAAGATTGCCAAGGAAAATGCTTAGGT bl2seq |
GenBank top hits |
Blast detail |
| Accession No. | Description | Score | e value |
|---|---|---|---|
| NP_568204 | ATP synthase beta chain 2, mitochondrial [Arabidopsis thaliana] | 257 | 3e-021 |
| NP_680155 | ATP synthase beta chain, mitochondrial, putative [Arabidopsis thaliana] | 257 | 3e-021 |
| P43395 | RecName: Full=ATP synthase subunit beta, mitochondrial | 257 | 3e-021 |
| CAC81058 | mitochondrial F1 ATP synthase beta subunit [Arabidopsis thaliana] | 257 | 3e-021 |
| P83483 | RecName: Full=ATP synthase subunit beta-1, mitochondrial; Flags: Precursor | 257 | 3e-021 |
Swiss-Prot top hits |
Blast detail |
| Accession No. | Description | Score | e value |
|---|---|---|---|
| P43395 | ATP synthase subunit beta, mitochondrial (Fragment) | 257 | 2e-022 |
| P83483 | ATP synthase subunit beta-1, mitochondrial | 257 | 2e-022 |
| P29685 | ATP synthase subunit beta, mitochondrial | 257 | 2e-022 |
| P83484 | ATP synthase subunit beta-2, mitochondrial | 257 | 2e-022 |
| Q9C5A9 | ATP synthase subunit beta-3, mitochondrial | 257 | 2e-022 |
TrEMBL top hits |
Blast detail |
| Accession No. | Description | Score | e value |
|---|---|---|---|
| A5AYU8 | ATP synthase subunit beta | 257 | 3e-021 |
| A7P3H0 | ATP synthase subunit beta | 257 | 3e-021 |
| A7PH19 | ATP synthase subunit beta | 257 | 3e-021 |
| A9PIH5 | ATP synthase subunit beta | 257 | 3e-021 |
| B9HWA2 | Mitochondrial beta subunit of F1 ATP synthase | 257 | 3e-021 |
Arabidopsis top hits |
Blast detail |
| Accession No. | Description | Score | e value |
|---|---|---|---|
| AT5G08670.1 | ATP binding / hydrogen ion transporting ATP synthase, rotational mechanism | 257 | 2e-023 |
| AT5G08680.1 | ATP synthase beta chain, mitochondrial, putative | 257 | 2e-023 |
| AT5G08690.1 | ATP synthase beta chain 2, mitochondrial | 257 | 2e-023 |
| ATCG00480.1 | chloroplast-encoded gene for beta subunit of ATP synthase | 190 | 9e-016 |
|
|