RU22458 sequence (186 bp)


Member Information
CTAAGGAGAGAGAGAGAGAGAGAGATGGAGGAAGCAAAGGGAGTGGTGAAGCATGTAGTGCTAGCCAAGTTCAAAGAAGGAG
TCTCTGAGTCTCAGATTGACCAACTAATCAAAGGCTATGCCAACCTCGTCAATCTCATTGATCCCATGGAGTCCTTCCACTG
GGGAAAGGACTTGAGCATTGAG


RU22458 Expression


Digital Expression:
ControlEthyleneWDSGenBankTotal
02002

Probe ID Probe Sequeces


RU22458 Annotation


GenBank top hits
Blast detail
Accession No. Description Score e value
NP_566569 stable protein 1-related [Arabidopsis thaliana] 223 3e-017
AAM63750 pop3 peptide [Arabidopsis thaliana] 223 3e-017
1Q53 Chain A, Solution Structure Of Hypothetical Arabidopsis Thaliana Protein At3g17210. Center For Eukaryotic Structural Genomics Target 13081 223 3e-017
CAO44961 unnamed protein product [Vitis vinifera] 219 9e-017
ABK93400 unknown [Populus trichocarpa] 218 1e-016

Swiss-Prot top hits
Blast detail
Accession No. Description Score e value
Q9LUV2 Putative protein Pop3 208 1e-016

TrEMBL top hits
Blast detail
Accession No. Description Score e value
Q0WKU8 Putative uncharacterized protein At3g17210 208 2e-015
A7Q8V2 Chromosome chr5 scaffold_64, whole genome shotgun sequence 204 5e-015
A9PAJ7 Putative uncharacterized protein 203 6e-015
A9PBJ5 Putative uncharacterized protein 203 6e-015
B9HMS2 Predicted protein 203 6e-015

Arabidopsis top hits
Blast detail
Accession No. Description Score e value
AT3G17210.1 HS1 (HEAT STABLE PROTEIN 1) 208 9e-018
AT5G22580.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Stress responsive alpha-beta barrel (InterPro:IPR013097), Dimeric alpha-beta barrel (InterPro:IPR011008); BEST Arabidopsis thaliana protein match is: HS1 (HEAT STABLE PROTEIN 1) (TAIR:AT3G17210.1); Has 231 Blast hits to 231 proteins in 57 species: Archae - 0; Bacteria - 89; Metazoa - 0; Fungi - 4; Plants - 98; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink). 112 1e-006