RU25387 sequence (307 bp)


Member Information
CTATGTCTGCATAAGTGTTTTGTCTCACTTGGCTTCCCAGTAGATTGTCCGTACCCAGAATAATCATACCCTATTAAGTTGA
CTCGGAGGTGAAGACTGAGCTCGCTGAAGAGCTCATACATCTGGCCCAGATCAGCTGCGTTACCGTGGGAGTGCAGAACGGT
GAGCTTCGCCGCCGGGTTCTTAAAGTAAACCGCGACGACGTCGTTTCCCCTCTTCGTCTTCAGCTTCAAAACGTCGACGTTC
GCCCTCGCCGGCACTCCCGCCATCCTCAGCTTCCCGCTCTCCTCCTCCTCCTCCACCCCGT


RU25387 Expression


Digital Expression:
ControlEthyleneWDSGenBankTotal
20103

Probe ID Probe Sequeces


RU25387 Annotation


GenBank top hits
 Blast detail
Accession No. Description Score e value
CAO49234 unnamed protein product [Vitis vinifera] 362 2e-033
CAN83201 hypothetical protein [Vitis vinifera] 360 4e-033
CAN67766 hypothetical protein [Vitis vinifera] 353 2e-032
ABK24504 unknown [Picea sitchensis] 351 4e-032
CAO15341 unnamed protein product [Vitis vinifera] 350 5e-032

Swiss-Prot top hits
 Blast detail
Accession No. Description Score e value
Q7ZVZ7 Abhydrolase domain-containing protein FAM108C1 185 4e-014
Q96GS6 Abhydrolase domain-containing protein FAM108A1 182 1e-013
Q6DEY3 Abhydrolase domain-containing protein FAM108B1 180 2e-013
Q6DCC5 Abhydrolase domain-containing protein FAM108B1 179 2e-013
Q2HJ19 Abhydrolase domain-containing protein FAM108A 178 3e-013

TrEMBL top hits
 Blast detail
Accession No. Description Score e value
B9T5S8 Protein bem46, putative 371 2e-034
A7PAG6 Chromosome chr14 scaffold_9, whole genome shotgun sequence 362 2e-033
A5BFR0 Putative uncharacterized protein 360 3e-033
Q9LI62 Similarity to unknown protein 354 2e-032
A5BCJ4 Putative uncharacterized protein 353 2e-032

Arabidopsis top hits
 Blast detail
Accession No. Description Score e value
AT3G30380.1 INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G01690.1); Has 3127 Blast hits to 3124 proteins in 513 species: Archae - 3; Bacteria - 775; Metazoa - 627; Fungi - 135; Plants - 158; Viruses - 6; Other Eukaryotes - 1423 (source: NCBI BLink). 354 1e-034
AT3G30380.2 INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G01690.1). 354 1e-034
AT5G14390.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G01690.1); Has 2904 Blast hits to 2898 proteins in 507 species: Archae - 0; Bacteria - 766; Metazoa - 578; Fungi - 129; Plants - 154; Viruses - 6; Other Eukaryotes - 1271 (source: NCBI BLink). 319 1e-030
AT3G01690.1 EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G14390.1); Has 2954 Blast hits to 2948 proteins in 496 species: Archae - 2; Bacteria - 741; Metazoa - 618; Fungi - 134; Plants - 170; Viruses - 6; Other Eukaryotes - 1283 (source: NCBI BLink). 316 2e-030
AT4G31020.2 unknown protein 310 1e-029