RU36031 sequence (237 bp)


Member Information
TTCAGGTGCTTGATCCTGATATTTGGTCACAAACCTATCCAAGAAGCGCTTCCTACTGTTTATCAGCATGGTAGCTTGAGAA
AGTTCTCCCTTTTTCATCAAACCCTTATATTGGAGAACTCTAATAACTGAACACCTAGGTATGATAGACTTCTCCAAACTAT
GAGTTAGAATATCCGGCCTGTCAGCCACTTCTGCAGGCTGCCCAACCCTATTTTTGTTCACAAGAAACTCAAT


RU36031 Expression


Digital Expression:
ControlEthyleneWDSGenBankTotal
10001

Probe ID Probe Sequeces


RU36031 Annotation


GenBank top hits
 Blast detail
Accession No. Description Score e value
CAN68939 hypothetical protein [Vitis vinifera] 167 9e-011
CAN68941 hypothetical protein [Vitis vinifera] 164 2e-010
CAO22399 unnamed protein product [Vitis vinifera] 162 3e-010
NP_173539 mitochondrial transcription termination factor family protein / mTERF family protein [Arabidopsis thaliana] 148 1e-008
AAF80646 Contains similarity to F28O16.19 a putative translation initiation factor IF-2 gi|6143896 from Arabidopsis thaliana gb|AC010718. It is a member of Elongation factor Tu family. ESTs gb|AI994592 and gb|T20793 come from thias gene 148 1e-008

Swiss-Prot top hits
Accession No. Description Score e value
no blast result!

TrEMBL top hits
 Blast detail
Accession No. Description Score e value
B9S3U4 Putative uncharacterized protein 180 3e-012
B9I9V1 Predicted protein 174 1e-011
A5AEZ1 Putative uncharacterized protein 167 9e-011
A5AEZ3 Putative uncharacterized protein 164 2e-010
A7PTX5 Chromosome chr7 scaffold_31, whole genome shotgun sequence 164 2e-010

Arabidopsis top hits
 Blast detail
Accession No. Description Score e value
AT1G21150.1 mitochondrial transcription termination factor family protein / mTERF family protein 148 8e-011
AT5G07900.1 mitochondrial transcription termination factor family protein / mTERF family protein 145 2e-010
AT1G61990.1 mitochondrial transcription termination factor-related / mTERF-related 126 3e-008
AT5G23930.1 mitochondrial transcription termination factor-related / mTERF-related 126 3e-008
AT1G62010.1 mitochondrial transcription termination factor-related / mTERF-related 125 4e-008