RU38171 sequence (148 bp)


Member Information
TTCAAGATCTTTCTGCAGTAAAGCCTTATAGTACTGTTTCTGCATTTGTGACATGCCTACTTTGAGTATTGTTTCTTTTTTC
GGAGGCAAACCTTTCTCAACATCTGACTTCAACCTTCGGAGAAGGAATGGCCGGAGGACCTTGTGA


RU38171 Expression


Digital Expression:
ControlEthyleneWDSGenBankTotal
10001

Probe ID Probe Sequeces
yueji_09686TCTTTTTTCGGAGGCAAACCTTTCTCAACATCTGACTTCAACCTTCGGAGAAGGAATGGC bl2seq


RU38171 Annotation


GenBank top hits
Blast detail
Accession No. Description Score e value
Q8RWY3 Putative chromatin-remodeling complex ATPase chain (ISW2-like) (Sucrose nonfermenting protein 2 homolog) 247 5e-020
NP_187291 CHR11 (CHROMATIN-REMODELING PROTEIN 11); DNA-dependent ATPase [Arabidopsis thaliana] 247 5e-020
NP_568365 CHR17 (CHROMATIN REMODELING FACTOR17); DNA-dependent ATPase [Arabidopsis thaliana] 247 5e-020
NP_850847 CHR17 (CHROMATIN REMODELING FACTOR17); DNA-dependent ATPase [Arabidopsis thaliana] 247 5e-020
AAM13851 putative ATPase (ISW2) [Arabidopsis thaliana] 247 5e-020

Swiss-Prot top hits
Blast detail
Accession No. Description Score e value
Q8RWY3 Putative chromatin-remodeling complex ATPase chain 247 3e-021
Q7G8Y3 Probable chromatin-remodeling complex ATPase chain 244 8e-021
O60264 SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 5 168 5e-012
Q91ZW3 SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 5 168 5e-012
P38144 ISWI chromatin-remodeling complex ATPase ISW1 166 8e-012

TrEMBL top hits
Blast detail
Accession No. Description Score e value
B9HSE5 Chromatin remodeling complex subunit (Fragment) 247 5e-020
Q3E9E6 Uncharacterized protein At5g18620.2 247 5e-020
B7EXS1 Putative uncharacterized protein 244 1e-019
B8A881 Putative uncharacterized protein 244 1e-019
B9HMQ1 Chromatin remodeling complex subunit (Fragment) 244 1e-019

Arabidopsis top hits
Blast detail
Accession No. Description Score e value
AT3G06400.1 CHR11 (CHROMATIN-REMODELING PROTEIN 11); ATP binding / DNA binding / DNA-dependent ATPase/ helicase/ hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding / nucleosome binding 247 3e-022
AT5G18620.1 CHR17 (CHROMATIN REMODELING FACTOR17); ATP binding / DNA binding / DNA-dependent ATPase/ helicase/ hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding / nucleosome binding 247 3e-022
AT5G18620.2 CHR17 (CHROMATIN REMODELING FACTOR17); ATP binding / DNA binding / DNA-dependent ATPase/ helicase/ hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding / nucleosome binding 247 3e-022
AT2G25170.1 PKL (PICKLE); ATPase/ DNA binding / DNA helicase 150 5e-011
AT2G13370.1 CHR5 (chromatin remodeling 5); ATP binding / DNA binding / chromatin binding / helicase/ nucleic acid binding 141 6e-010