Member Information |
| GCCTGTGCTTTTTTGAATTTGAGAACCTCTCCAAAAGCTGAACAAAATTCCATAAATTGCAGAGCGTTTCCAGCATCCTCAG GAGGCAGTTCAATTCCCAAGACACTTGTTAAGGGAATGCCCTCAGGCAAAGGAAGCTCAGGCTCAACTTTTTTGTTCAGAAT ATTCTTGGTGCATTCCTCAACTCTGCAAGTCTCTTTGCTACTCTTGACCTTGTCCTTGGCCTTTTTCTTCCTCTTAACATCA TTGTTGTTCACAACATTTT |
Digital Expression: |
| Control | Ethylene | WDS | GenBank | Total |
|---|---|---|---|---|
| 1 | 0 | 0 | 0 | 1 |
| Probe ID | Probe Sequeces |
GenBank top hits |
Blast detail |
| Accession No. | Description | Score | e value |
|---|---|---|---|
| CAO49292 | unnamed protein product [Vitis vinifera] | 165 | 2e-010 |
| CAO49279 | unnamed protein product [Vitis vinifera] | 164 | 2e-010 |
| AAG00254 | F1N21.9 [Arabidopsis thaliana] | 153 | 4e-009 |
| NP_176944 | unknown protein [Arabidopsis thaliana] | 151 | 6e-009 |
| BAB10159 | unnamed protein product [Arabidopsis thaliana] | 150 | 8e-009 |
Swiss-Prot top hits |
| Accession No. | Description | Score | e value |
|---|---|---|---|
| no blast result! | |||
TrEMBL top hits |
Blast detail |
| Accession No. | Description | Score | e value |
|---|---|---|---|
| B9IL04 | Predicted protein | 151 | 6e-009 |
| B9RSM2 | Ubiquitin-protein ligase, putative | 139 | 2e-007 |
| B9HAH0 | Predicted protein | 137 | 3e-007 |
| A7PAL1 | Chromosome chr14 scaffold_9, whole genome shotgun sequence | 130 | 2e-006 |
| A7PAM4 | Chromosome chr14 scaffold_9, whole genome shotgun sequence | 124 | 8e-006 |
Arabidopsis top hits |
Blast detail |
| Accession No. | Description | Score | e value |
|---|---|---|---|
| AT5G38690.1 | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DDT superfamily (InterPro:IPR018501), DDT subgroup (InterPro:IPR018500), Cell division cycle-associated protein (InterPro:IPR018866); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G67780.1); Has 492 Blast hits to 468 proteins in 97 species: Archae - 9; Bacteria - 41; Metazoa - 179; Fungi - 19; Plants - 99; Viruses - 2; Other Eukaryotes - 143 (source: NCBI BLink). | 121 | 1e-007 |
| AT1G67780.1 | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot apex, flower, root, seed; EXPRESSED DURING: petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: DDT superfamily (InterPro:IPR018501), DDT subgroup (InterPro:IPR018500), Cell division cycle-associated protein (InterPro:IPR018866); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G67270.1); Has 280 Blast hits to 277 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 47; Plants - 92; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink). | 106 | 6e-006 |
|
|