RU45810 sequence (182 bp)


Member Information
TCACTCCTCCGGTCGCCGGAGCCGACTTCCTGGCAGCCTTGGTCGCCAGCTGCTTCCTCGGCGCCTTTCCTCCGGTGGACTT
GCGAGCTGTCTGCTTGGTACGAGCCATTGTGAAGAAGAAGAAGAAGAAGAAGGATTAGGGTTTGGGTTTTGGGAATTTTGGG
TTTAAGCGATTGGAATTT


RU45810 Expression


Digital Expression:
ControlEthyleneWDSGenBankTotal
01001

Probe ID Probe Sequeces
yueji_09322CTTCCTCGGCGCCTTTCCTCCGGTGGACTTGCGAGCTGTCTGCTTGGTACGAGCCATTGT bl2seq


RU45810 Annotation


GenBank top hits
Blast detail
Accession No. Description Score e value
XP_001072050 PREDICTED: similar to H3 histone, family 2 isoform 2 [Rattus norvegicus] 188 4e-013
XP_001491472 PREDICTED: similar to histone H3.2 [Equus caballus] 186 6e-013
XP_001491419 PREDICTED: similar to histone H3.2 [Equus caballus] 186 6e-013
XP_001366176 PREDICTED: similar to histone protein Hist2h3c1 [Monodelphis domestica] 185 8e-013
NP_835734 histone cluster 2, H3c1 isoform 2 [Mus musculus] 182 2e-012

Swiss-Prot top hits
Blast detail
Accession No. Description Score e value
P68432 Histone H3.1 176 6e-013
P68431 Histone H3.1 176 6e-013
P68433 Histone H3.1 176 6e-013
Q6LBF0 Histone H3.1 176 6e-013
Q6LED0 Histone H3.1 176 6e-013

TrEMBL top hits
Blast detail
Accession No. Description Score e value
B0WTE0 Histone H3 178 5e-012
A5PLR1 Histone H3 176 9e-012
Q5TEC6 Histone H3 176 9e-012
A2CI33 Histone H3 176 9e-012
A3RJP1 Histone H3 (Fragment) 176 9e-012

Arabidopsis top hits
Blast detail
Accession No. Description Score e value
AT1G09200.1 histone H3 176 5e-014
AT3G27360.1 histone H3 176 5e-014
AT5G10390.1 histone H3 176 5e-014
AT5G10400.1 histone H3 176 5e-014
AT5G65360.1 histone H3 176 5e-014