Member Information |
| AAGTTAAAATAAAGTTTAACCTTAAAAGACAACAAAAGTAAAGTAGGTTAGACAAAGTAACCCAATGAAAGATGTGCTCGTA GGCATCTATCCCAAAACAATTGTGCTCCTTTAACTGATGTTCCAACTGTGATAGTTGGCCCAATTTTGTTGATAGTGCACTC AGGACAATACCAGGATCCTTCTGGTATCGACAGTTTCATCACACCTATACACCTCGTATGGTAGGCGGATGGGCATCCATCA CAGCAAAGC |
Digital Expression: |
| Control | Ethylene | WDS | GenBank | Total |
|---|---|---|---|---|
| 0 | 1 | 0 | 0 | 1 |
| Probe ID | Probe Sequeces |
| yueji_14174 | AATACCAGGATCCTTCTGGTATCGACAGTTTCATCACACCTATACACCTCGTATGGTAGG bl2seq |
GenBank top hits |
Blast detail |
| Accession No. | Description | Score | e value |
|---|---|---|---|
| CAO16702 | unnamed protein product [Vitis vinifera] | 251 | 2e-020 |
| BAB11682 | unnamed protein product [Arabidopsis thaliana] | 226 | 1e-017 |
| NP_197668 | PHD finger family protein [Arabidopsis thaliana] | 226 | 1e-017 |
| BAA98208 | unnamed protein product [Arabidopsis thaliana] | 224 | 2e-017 |
| NP_198371 | peptidase M50 family protein / sterol-regulatory element binding protein (SREBP) site 2 protease family protein [Arabidopsis thaliana] | 224 | 2e-017 |
Swiss-Prot top hits |
Blast detail |
| Accession No. | Description | Score | e value |
|---|---|---|---|
| O97159 | Chromodomain-helicase-DNA-binding protein Mi-2 homolog | 125 | 4e-007 |
| Q8TDI0 | Chromodomain-helicase-DNA-binding protein 5 | 122 | 1e-006 |
| O16102 | Chromodomain-helicase-DNA-binding protein 3 | 121 | 1e-006 |
| Q96L73 | Histone-lysine N-methyltransferase, H3 lysine-36 and H4 lysine-20 specific | 121 | 1e-006 |
| O88491 | Histone-lysine N-methyltransferase, H3 lysine-36 and H4 lysine-20 specific | 121 | 1e-006 |
TrEMBL top hits |
Blast detail |
| Accession No. | Description | Score | e value |
|---|---|---|---|
| B9SN69 | DNA binding protein, putative | 259 | 2e-021 |
| A7PQK3 | Chromosome chr6 scaffold_25, whole genome shotgun sequence | 251 | 2e-020 |
| B9HQK7 | Predicted protein | 241 | 2e-019 |
| Q9FNI5 | Gb|AAC80581.1 | 226 | 1e-017 |
| Q3E8P3 | Uncharacterized protein At5g35210.1 | 224 | 2e-017 |
Arabidopsis top hits |
Blast detail |
| Accession No. | Description | Score | e value |
|---|---|---|---|
| AT5G22760.1 | PHD finger family protein | 226 | 7e-020 |
| AT5G35210.1 | peptidase M50 family protein / sterol-regulatory element binding protein (SREBP) site 2 protease family protein | 224 | 1e-019 |
| AT5G35210.2 | peptidase M50 family protein / sterol-regulatory element binding protein (SREBP) site 2 protease family protein | 224 | 1e-019 |
| AT5G12400.1 | PHD finger transcription factor, putative | 173 | 1e-013 |
| AT1G05380.1 | DNA binding | 129 | 1e-008 |
|
|