RU53022 sequence (232 bp)


Member Information
ATCGACCATCAATCTCTCTCACTCTATATATCTCCATCAACAAACGGAGGTGACCTGAAATCACAAGGAGAGAGAATCATCA
CCATCACCACCACCACCACCACCAAACCATGTGGCGGAGAATCCTCTCTTCGGCTCAGCTCAGAACCCTAACCCTAGCCACC
TCCTCCTCCTCCGCCGCCGCCGCCGCCGCCCGCCCCATCGCCGATCCCGCCGCCGGCCGCACTCCGCT


RU53022 Expression


Digital Expression:
ControlEthyleneWDSGenBankTotal
01001

Probe ID Probe Sequeces


RU53022 Annotation


GenBank top hits
 Blast detail
Accession No. Description Score e value
XP_540507 PREDICTED: similar to multidomain presynaptic cytomatrix protein Piccolo [Canis familiaris] 137 3e-007
XP_536630 PREDICTED: similar to Vesicle-associated membrane protein 2 (VAMP-2) (Synaptobrevin 2) [Canis familiaris] 135 5e-007
CAB60732 aczonin [Mus musculus] 134 6e-007
CAB60731 aczonin [Mus musculus] 134 6e-007
Q9QYX7 RecName: Full=Protein piccolo; AltName: Full=Aczonin; AltName: Full=Multidomain presynaptic cytomatrix protein; AltName: Full=Brain-derived HLMN protein 134 6e-007

Swiss-Prot top hits
Accession No. Description Score e value
no blast result!

TrEMBL top hits
Accession No. Description Score e value
no blast result!

Arabidopsis top hits
Accession No. Description Score e value
no blast result!