RU58761 sequence (289 bp)


Member Information
GGATTTTCTTTTCAGCAGCAACCGAAGACGTAACAACTACTACCAACACCCGCCGCCGCCTCAGCCCCTCTACCTCTCCAAT
CCTCACTACTACCCCTCCGACCCACCCTCTTTCTCTCCGCCGCCGCCGCCGCCACCTCCTCCGCCGCCGGTGACTTCTTTTT
CTTCCTCCTCCTCCTCCTCTTCTTCTTCCGCCACCTACCCAGAACCCAATTCCGCCACCCCTTACGCCGCGCCGCCGCCCAG
GGCTCCATACCAGGCCTACCCTCTTCCGCCGCCGCCGCCGCCG


RU58761 Expression


Digital Expression:
ControlEthyleneWDSGenBankTotal
01001

Probe ID Probe Sequeces


RU58761 Annotation


GenBank top hits
 Blast detail
Accession No. Description Score e value
ABA41400 pherophorin-C2 protein precursor [Chlamydomonas reinhardtii] 177 6e-012
YP_293890 hypothetical protein EhV137 [Emiliania huxleyi virus 86] 176 8e-012
YP_002296191 putative membrane protein [Emiliania huxleyi virus 86] 176 8e-012
XP_425925 PREDICTED: similar to zinc-finger homeodomain protein 4 isoform 2 [Gallus gallus] 173 2e-011
XP_001232201 PREDICTED: similar to zinc-finger homeodomain protein 4 isoform 1 [Gallus gallus] 173 2e-011

Swiss-Prot top hits
 Blast detail
Accession No. Description Score e value
Q5Z8K3 Adagio-like protein 1 117 3e-006

TrEMBL top hits
Accession No. Description Score e value
no blast result!

Arabidopsis top hits
 Blast detail
Accession No. Description Score e value
AT4G36230.1 unknown protein 132 5e-009
AT5G35660.1 LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Glycine rich (InterPro:IPR010800). 111 1e-006